bio-small-rna-seq-smrna-preprocessing
Preprocess small RNA sequencing data with adapter trimming and size selection optimized for miRNA, piRNA, and other small RNAs. Use when preparing small RNA-seq reads for downstream quantification or discovery analysis.
npx skills add BioTender-max/awesome-bio-agent-skills --skill smrna-preprocessing --agent claude-code
Same command for any agent — swap --agent for codex, cursor, copilot.
Weekly change comes from our own snapshots, not the repository page — it measures attention, not adoption.
## Version Compatibility Reference examples tested with: cutadapt 4.4+, fastp 0.23+, matplotlib 3.8+ Before using code patterns, verify installed versions match. If versions differ: - Python: `pip show <package>` then `help(module.function)` to check signatures - CLI: `<tool> --version` then `<tool> --help` to confirm flags If code throws ImportError, AttributeError, or TypeError, introspect the installed package and adapt the example to match the actual API rather than retrying. # Small RNA Preprocessing **"Preprocess my small RNA-seq reads"** → Remove 3' adapter sequences and size-select reads in the small RNA range (18-30 nt for miRNA, 24-32 nt for piRNA) before quantification or discovery. - CLI: `cutadapt -a ADAPTER -m 18 -M 30 -o trimmed.fastq input.fastq` ## Adapter Trimming with Cutadapt **Goal:** Remove 3' adapter sequences and size-select reads in the small RNA range. **Approach:** Run cutadapt with the kit-specific adapter, minimum/maximum length filters, and discard reads without adapter. Small RNA libraries have specific 3' adapters that must be removed: ```bash # Standard Illumina TruSeq small RNA adapter cutadapt \ -a TGGAATTCTCGGGTGCCAAGG \ -m 18 \ -M 30 \ --discard
- Version Compatibility
- Adapter Trimming with Cutadapt
- Common Small RNA Adapters
- Size Selection
- Quality Trimming
- Using fastp for Small RNA
- Collapse Identical Reads
- Python Preprocessing
- QC Metrics for Small RNA
- Related Skills
Standard Illumina TruSeq small RNA adapter cutadapt \ input.fastq.gz Filter by length after trimming Trim low-quality bases from 3' end before adapter removal fastp with small RNA settings fastp \ Using seqkit seqkit rmdup -s trimmed.fastq.gz -o collapsed.fasta Using fastx_toolkit (legacy)
What does the bio-small-rna-seq-smrna-preprocessing skill do?
Preprocess small RNA sequencing data with adapter trimming and size selection optimized for miRNA, piRNA, and other small RNAs. Use when preparing small RNA-seq reads for downstream quantification or discovery analysis.
How do I install it?
Run `npx skills add BioTender-max/awesome-bio-agent-skills --skill smrna-preprocessing --agent claude-code` — it drops the skill into your project so the agent can pick it up. Swap the --agent value for codex, cursor or copilot if you use one of those.
Where does this skill come from?
From BioTender-max/awesome-bio-agent-skills, a repository with 135 stars. We read it straight from the repository tree rather than a submitted listing, so what you see here is what is actually published.
Is a popular skill a good skill?
Not necessarily. Stars measure attention, not adoption — a repository can trend for a week and be abandoned. That is why we show the weekly change from our own snapshots next to the total, instead of a single flattering number.