Agent skill · Data & Analytics

bio-workflows-smrna-pipeline

End-to-end small RNA-seq analysis from FASTQ to differential miRNA expression. Use when analyzing miRNA, piRNA, or other small RNA sequencing data.

BioTender-maxgithub.com/BioTender-maxGitHub ↗
claude-codeships scriptsNOASSERTION
Install
npx skills add BioTender-max/awesome-bio-agent-skills --skill smrna-pipeline --agent claude-code

Same command for any agent — swap --agent for codex, cursor, copilot.

Facts
Files in the skill folder: 3
SKILL.md size: 2 KB
Bundled scripts: yes
Path: skills/bioskills/smrna-pipeline/SKILL.md
Open the folder on GitHub →
Where it comes from
Stars: 135
Language: Python

Weekly change comes from our own snapshots, not the repository page — it measures attention, not adoption.

From the SKILL.md

## Version Compatibility Reference examples tested with: DESeq2 1.42+, cutadapt 4.4+ Before using code patterns, verify installed versions match. If versions differ: - R: `packageVersion('<pkg>')` then `?function_name` to verify parameters - CLI: `<tool> --version` then `<tool> --help` to confirm flags If code throws ImportError, AttributeError, or TypeError, introspect the installed package and adapt the example to match the actual API rather than retrying. # Small RNA-seq Pipeline **"Analyze my small RNA-seq data from FASTQ to differential miRNAs"** → Orchestrate adapter trimming (cutadapt), miRNA quantification (miRDeep2/miRge3), novel miRNA discovery, differential expression (DESeq2), and target prediction (miRanda). ## Pipeline Overview ``` FASTQ → cutadapt trim → miRDeep2 → Quantification → DESeq2 → Target prediction ``` ## Step 1: Preprocessing ```bash # Adapter trimming and size selection cutadapt -a TGGAATTCTCGGGTGCCAAGG \ --minimum-length 18 --maximum-length 30 \ -o trimmed.fastq.gz reads.fastq.gz ``` ## Step 2: miRDeep2 Analysis ```bash # Align to genome mapper.pl trimmed.fastq.gz -e -h -i -j -l 18 \ -m -p genome_index -s reads_collapsed.fa \ -t reads_collapsed_vs_genome

What's inside
Steps it walks through
  1. Version Compatibility
  2. Pipeline Overview
  3. Step 1: Preprocessing
  4. Step 2: miRDeep2 Analysis
  5. Step 3: Differential Expression
  6. Step 4: Target Prediction
  7. QC Checkpoints
  8. Related Skills
Ships with 2 files
  • examples/smrna_full_pipeline.sh
  • usage-guide.md
Commands it runs
Adapter trimming and size selection
cutadapt -a TGGAATTCTCGGGTGCCAAGG \
Align to genome
mapper.pl trimmed.fastq.gz -e -h -i -j -l 18 \
miRNA quantification and novel prediction
miRDeep2.pl reads_collapsed.fa genome.fa \
reads_collapsed_vs_genome.arf \
mature_ref.fa none hairpin_ref.fa
miRanda for target prediction
miranda mature_mirnas.fa target_3utrs.fa -out targets.txt
More from awesome-bio-agent-skills
All skills →
About this skill
What does the bio-workflows-smrna-pipeline skill do?

End-to-end small RNA-seq analysis from FASTQ to differential miRNA expression. Use when analyzing miRNA, piRNA, or other small RNA sequencing data.

How do I install it?

Run `npx skills add BioTender-max/awesome-bio-agent-skills --skill smrna-pipeline --agent claude-code` — it drops the skill into your project so the agent can pick it up. Swap the --agent value for codex, cursor or copilot if you use one of those.

Where does this skill come from?

From BioTender-max/awesome-bio-agent-skills, a repository with 135 stars. We read it straight from the repository tree rather than a submitted listing, so what you see here is what is actually published.

Is a popular skill a good skill?

Not necessarily. Stars measure attention, not adoption — a repository can trend for a week and be abandoned. That is why we show the weekly change from our own snapshots next to the total, instead of a single flattering number.

Keep going