bio-sequence-properties
Calculate sequence properties like GC content, molecular weight, isoelectric point, and GC skew using Biopython. Use when analyzing sequence composition, computing physical properties, or comparing sequences.
npx skills add BioTender-max/awesome-bio-agent-skills --skill sequence-properties --agent claude-code
Same command for any agent — swap --agent for codex, cursor, copilot.
Weekly change comes from our own snapshots, not the repository page — it measures attention, not adoption.
## Version Compatibility Reference examples tested with: BioPython 1.83+, samtools 1.19+ Before using code patterns, verify installed versions match. If versions differ: - Python: `pip show <package>` then `help(module.function)` to check signatures If code throws ImportError, AttributeError, or TypeError, introspect the installed package and adapt the example to match the actual API rather than retrying. # Sequence Properties Calculate physical and chemical properties of biological sequences using Biopython. **"Calculate GC content"** → Compute the fraction of G+C bases in a nucleotide sequence. - Python: `gc_fraction(seq)` (BioPython SeqUtils) **"Analyze protein properties"** → Compute MW, pI, stability, hydrophobicity from an amino acid sequence. - Python: `ProteinAnalysis(str_seq)` (BioPython ProtParam) ## Required Imports ```python from Bio.Seq import Seq from Bio.SeqUtils import gc_fraction, molecular_weight, GC123, GC_skew, nt_search, seq1, seq3 from Bio.SeqUtils.ProtParam import ProteinAnalysis ``` ## DNA/RNA Properties ### GC Content ```python from Bio.SeqUtils import gc_fraction seq = Seq('ATGCGATCGATCGATCGATCG') gc = gc_fraction(seq) # Returns 0.476... (fraction) gc_perc
- Version Compatibility
- Required Imports
- DNA/RNA Properties
- GC Content
- GC at Codon Positions (GC123)
- GC Skew
- Molecular Weight
- Melting Temperature
- Sequence Search with IUPAC Codes (ntsearch)
- Base Composition
- Amino Acid Code Conversion
- Protein Properties
- Using ProteinAnalysis
- Basic Properties
What does the bio-sequence-properties skill do?
Calculate sequence properties like GC content, molecular weight, isoelectric point, and GC skew using Biopython. Use when analyzing sequence composition, computing physical properties, or comparing sequences.
How do I install it?
Run `npx skills add BioTender-max/awesome-bio-agent-skills --skill sequence-properties --agent claude-code` — it drops the skill into your project so the agent can pick it up. Swap the --agent value for codex, cursor or copilot if you use one of those.
Where does this skill come from?
From BioTender-max/awesome-bio-agent-skills, a repository with 135 stars. We read it straight from the repository tree rather than a submitted listing, so what you see here is what is actually published.
Is a popular skill a good skill?
Not necessarily. Stars measure attention, not adoption — a repository can trend for a week and be abandoned. That is why we show the weekly change from our own snapshots next to the total, instead of a single flattering number.