bio-primer-design-qpcr-primers
Design qPCR primers and TaqMan/molecular beacon probes using primer3-py. Configure probe Tm, primer-probe spacing, and hydrolysis probe constraints for real-time PCR assays. Use when designing qPCR primers and probes.
npx skills add BioTender-max/awesome-bio-agent-skills --skill qpcr-primers --agent claude-code
Same command for any agent — swap --agent for codex, cursor, copilot.
Weekly change comes from our own snapshots, not the repository page — it measures attention, not adoption.
## Version Compatibility Reference examples tested with: BioPython 1.83+, pandas 2.2+, primer3-py 2.0+ Before using code patterns, verify installed versions match. If versions differ: - Python: `pip show <package>` then `help(module.function)` to check signatures If code throws ImportError, AttributeError, or TypeError, introspect the installed package and adapt the example to match the actual API rather than retrying. # qPCR Primer and Probe Design Design primers and internal probes for quantitative PCR using primer3-py. **"Design qPCR primers with probe"** → Generate primer pairs plus internal TaqMan/molecular beacon probes with constrained Tm and spacing. - Python: `primer3.design_primers(seq_args, global_args)` with `PRIMER_PICK_INTERNAL_OLIGO=1` (primer3-py) ## Required Imports ```python import primer3 from Bio import SeqIO ``` ## Design Primers with TaqMan Probe ```python sequence = 'ATGCGTACGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCG' * 3 result = primer3.design_primers( seq_args={'SEQUENCE_TEMPLATE': sequence}, global_args={ 'PRIMER_PICK_LEFT_PRIMER': 1, 'PRIMER_PICK_RIGHT_PRIMER': 1, 'PRIMER_PICK_INTERNAL_OLIGO': 1, # Design internal probe 'PRIMER_PRODUCT_SIZ
- Version Compatibility
- Required Imports
- Design Primers with TaqMan Probe
- Extract Probe Results
- qPCR-Optimized Parameters
- TaqMan Probe Constraints
- SYBR Green Primers (No Probe)
- Design for Exon-Spanning (Avoid Genomic DNA)
- Multiplex Primer Design
- Validate Tm Calculations
- Format qPCR Results
- qPCR Design Guidelines
- Related Skills
What does the bio-primer-design-qpcr-primers skill do?
Design qPCR primers and TaqMan/molecular beacon probes using primer3-py. Configure probe Tm, primer-probe spacing, and hydrolysis probe constraints for real-time PCR assays. Use when designing qPCR primers and probes.
How do I install it?
Run `npx skills add BioTender-max/awesome-bio-agent-skills --skill qpcr-primers --agent claude-code` — it drops the skill into your project so the agent can pick it up. Swap the --agent value for codex, cursor or copilot if you use one of those.
Where does this skill come from?
From BioTender-max/awesome-bio-agent-skills, a repository with 135 stars. We read it straight from the repository tree rather than a submitted listing, so what you see here is what is actually published.
Is a popular skill a good skill?
Not necessarily. Stars measure attention, not adoption — a repository can trend for a week and be abandoned. That is why we show the weekly change from our own snapshots next to the total, instead of a single flattering number.