bio-primer-design-primer-validation
Validate PCR primers for specificity, dimers, hairpins, and secondary structures using primer3-py thermodynamic calculations. Check self-complementarity, heterodimer formation, and 3' stability. Use when validating primer specificity and properties.
npx skills add BioTender-max/awesome-bio-agent-skills --skill primer-validation --agent claude-code
Same command for any agent — swap --agent for codex, cursor, copilot.
Weekly change comes from our own snapshots, not the repository page — it measures attention, not adoption.
## Version Compatibility Reference examples tested with: pandas 2.2+, primer3-py 2.0+ Before using code patterns, verify installed versions match. If versions differ: - Python: `pip show <package>` then `help(module.function)` to check signatures If code throws ImportError, AttributeError, or TypeError, introspect the installed package and adapt the example to match the actual API rather than retrying. # Primer Validation Check primers for secondary structures, dimers, and other issues using primer3-py. **"Validate a primer pair"** → Check for hairpins, self-dimers, heterodimers, and 3' stability using thermodynamic calculations. - Python: `primer3.calc_hairpin()`, `primer3.calc_homodimer()`, `primer3.calc_heterodimer()` (primer3-py) ## Required Imports ```python import primer3 ``` ## Check Hairpin Formation ```python primer = 'ATGCGATCGATCGATCGATC' hairpin = primer3.calc_hairpin(primer) print(f'Hairpin Tm: {hairpin.tm:.1f}C') print(f'Hairpin dG: {hairpin.dg:.1f} cal/mol') print(f'Hairpin dH: {hairpin.dh:.1f} cal/mol') print(f'Hairpin dS: {hairpin.ds:.1f} cal/mol/K') # Hairpin is problematic if Tm > annealing temp - 10 annealing_temp = 60.0 if hairpin.tm > annealing_temp - 10: prin
- Version Compatibility
- Required Imports
- Check Hairpin Formation
- Check Self-Dimer (Homodimer)
- Check Primer-Primer Dimer (Heterodimer)
- Complete Primer Validation
- Validate Primer Pair
- Calculate End Stability (Native Function)
- Quick Tm-Only Checks (Lightweight)
- Fast Batch Screening with Tm-Only Functions
- Check Specificity (3' End)
- Batch Validation
- Thermodynamic Parameters Under Different Conditions
- Validation Thresholds
What does the bio-primer-design-primer-validation skill do?
Validate PCR primers for specificity, dimers, hairpins, and secondary structures using primer3-py thermodynamic calculations. Check self-complementarity, heterodimer formation, and 3' stability. Use when validating primer specificity and properties.
How do I install it?
Run `npx skills add BioTender-max/awesome-bio-agent-skills --skill primer-validation --agent claude-code` — it drops the skill into your project so the agent can pick it up. Swap the --agent value for codex, cursor or copilot if you use one of those.
Where does this skill come from?
From BioTender-max/awesome-bio-agent-skills, a repository with 135 stars. We read it straight from the repository tree rather than a submitted listing, so what you see here is what is actually published.
Is a popular skill a good skill?
Not necessarily. Stars measure attention, not adoption — a repository can trend for a week and be abandoned. That is why we show the weekly change from our own snapshots next to the total, instead of a single flattering number.