bio-motif-search
Find patterns, motifs, and subsequences in biological sequences using Biopython. Use when searching for transcription factor binding sites, regulatory elements, or any sequence pattern. For restriction enzyme analysis, use the restriction-analysis skill.
npx skills add BioTender-max/awesome-bio-agent-skills --skill motif-search --agent claude-code
Same command for any agent — swap --agent for codex, cursor, copilot.
Weekly change comes from our own snapshots, not the repository page — it measures attention, not adoption.
## Version Compatibility Reference examples tested with: BioPython 1.83+ Before using code patterns, verify installed versions match. If versions differ: - Python: `pip show <package>` then `help(module.function)` to check signatures If code throws ImportError, AttributeError, or TypeError, introspect the installed package and adapt the example to match the actual API rather than retrying. # Motif Search **"Search for a sequence motif or binding site pattern"** → Scan sequences for patterns using IUPAC ambiguity codes, regex, or position weight matrices to locate transcription factor binding sites, regulatory elements, or custom motifs. - Python: `Bio.motifs` for PWM scanning, `re` for regex pattern matching Find patterns and motifs in biological sequences using Biopython and regex. ## Required Imports ```python from Bio.Seq import Seq from Bio import motifs import re ``` ## Core Methods ### find() - First Occurrence ```python seq = Seq('ATGCGAATTCGATCGAATTCGATC') pos = seq.find('GAATTC') # Returns 4 (first position) ``` Returns -1 if not found. ### count() - Count Occurrences ```python seq = Seq('ATGCGAATTCGATCGAATTCGATC') n = seq.count('GAATTC') # Returns 2 ``` ### find() with St
- Version Compatibility
- Required Imports
- Core Methods
- find() - First Occurrence
- count() - Count Occurrences
- find() with Start Position
- Code Patterns
- Find All Occurrences
- Search Both Strands
- Regex Pattern Search
- IUPAC Ambiguity Pattern
- Find ORFs (Start to Stop)
- Find Repeats
- Bio.motifs Module
What does the bio-motif-search skill do?
Find patterns, motifs, and subsequences in biological sequences using Biopython. Use when searching for transcription factor binding sites, regulatory elements, or any sequence pattern. For restriction enzyme analysis, use the restriction-analysis skill.
How do I install it?
Run `npx skills add BioTender-max/awesome-bio-agent-skills --skill motif-search --agent claude-code` — it drops the skill into your project so the agent can pick it up. Swap the --agent value for codex, cursor or copilot if you use one of those.
Where does this skill come from?
From BioTender-max/awesome-bio-agent-skills, a repository with 135 stars. We read it straight from the repository tree rather than a submitted listing, so what you see here is what is actually published.
Is a popular skill a good skill?
Not necessarily. Stars measure attention, not adoption — a repository can trend for a week and be abandoned. That is why we show the weekly change from our own snapshots next to the total, instead of a single flattering number.