bio-small-rna-seq-mirge3-analysis
Fast miRNA quantification with isomiR detection and A-to-I editing analysis using miRge3. Use when quantifying known miRNAs quickly or analyzing isomiR variants and RNA editing.
npx skills add BioTender-max/awesome-bio-agent-skills --skill mirge3-analysis --agent claude-code
Same command for any agent — swap --agent for codex, cursor, copilot.
Weekly change comes from our own snapshots, not the repository page — it measures attention, not adoption.
## Version Compatibility Reference examples tested with: numpy 1.26+, pandas 2.2+ Before using code patterns, verify installed versions match. If versions differ: - Python: `pip show <package>` then `help(module.function)` to check signatures - CLI: `<tool> --version` then `<tool> --help` to confirm flags If code throws ImportError, AttributeError, or TypeError, introspect the installed package and adapt the example to match the actual API rather than retrying. # miRge3 Analysis **"Quantify miRNAs with isomiR detection"** → Fast miRNA annotation and quantification with isomiR variant detection and A-to-I RNA editing analysis from small RNA-seq reads. - CLI: `miRge3.0 annotate -s sample.fastq -lib human -db mirgenedb -o results/` ## Basic Quantification **Goal:** Quantify known miRNA expression from small RNA-seq FASTQ files. **Approach:** Run miRge3 annotation pipeline with adapter trimming, organism-specific libraries, and multi-sample input. ```bash # Run miRge3 on FASTQ files miRge3.0 annotate \ -s sample1.fastq.gz,sample2.fastq.gz \ -lib miRge3_libs \ -on human \ -db mirbase \ -o output_dir \ -a TGGAATTCTCGGGTGCCAAGG \ --threads 8 # Key options: # -s: Input FASTQ files (comma-s
- Version Compatibility
- Basic Quantification
- Install miRge3 Libraries
- IsomiR Detection
- A-to-I RNA Editing
- Output Files
- Python API
- Parse miRge3 Output
- Compare Multiple Samples
- IsomiR Analysis
- Related Skills
Run miRge3 on FASTQ files miRge3.0 annotate \ Key options: Download pre-built libraries miRge3.0 --download-library human mirbase Libraries include: Enable isomiR analysis IsomiRs include: Detect A-to-I editing Outputs editing sites and frequencies
What does the bio-small-rna-seq-mirge3-analysis skill do?
Fast miRNA quantification with isomiR detection and A-to-I editing analysis using miRge3. Use when quantifying known miRNAs quickly or analyzing isomiR variants and RNA editing.
How do I install it?
Run `npx skills add BioTender-max/awesome-bio-agent-skills --skill mirge3-analysis --agent claude-code` — it drops the skill into your project so the agent can pick it up. Swap the --agent value for codex, cursor or copilot if you use one of those.
Where does this skill come from?
From BioTender-max/awesome-bio-agent-skills, a repository with 135 stars. We read it straight from the repository tree rather than a submitted listing, so what you see here is what is actually published.
Is a popular skill a good skill?
Not necessarily. Stars measure attention, not adoption — a repository can trend for a week and be abandoned. That is why we show the weekly change from our own snapshots next to the total, instead of a single flattering number.