Agent skill · Media & Video

bio-clip-seq-ago-clip-mirna-targets

Identify direct miRNA-target interactions from AGO HITS-CLIP, AGO-CLEAR-CLIP (chimeric reads), HEAP (Halo-Ago2 mouse), chimeric eCLIP / miR-eCLIP (deep miRNA-target profiling), or CLASH using chimeric-read processing pipelines, seed-pairing analysis, and 3' auxiliary pairing rules. Use when distinguishing direct miRNA targets from indirect, integrating CLIP-derived target maps with TargetScan / miRDB / DIANA predictions, applying canonical 7mer-8mer seed matching with 3' UTR context, or recovering miRNA-mRNA chimeras at scale.

BioTender-maxgithub.com/BioTender-maxGitHub ↗
claude-codeships scriptsNOASSERTION
Install
npx skills add BioTender-max/awesome-bio-agent-skills --skill ago-clip-mirna-targets --agent claude-code

Same command for any agent — swap --agent for codex, cursor, copilot.

Facts
Files in the skill folder: 3
SKILL.md size: 20 KB
Bundled scripts: yes
Path: skills/bioskills/ago-clip-mirna-targets/SKILL.md
Open the folder on GitHub →
Where it comes from
Stars: 135
Language: Python

Weekly change comes from our own snapshots, not the repository page — it measures attention, not adoption.

From the SKILL.md

## Version Compatibility Reference examples tested with: eCLIP pipeline (Yeo lab), chimeric eCLIP analysis scripts (Manakov 2022), HEAP pipeline (Li 2020), Hyb pipeline (Travis 2014), TargetScanHuman 8.0, miRDB 6.0, samtools 1.19+, bedtools 2.31+, pyHyb 0.4+. Before using code patterns, verify installed versions match. If versions differ: - Python: `pip show <package>` then `help(module.function)` to check signatures - CLI: `<tool> --version` then `<tool> --help` to confirm flags If code throws unexpected errors, introspect the installed package and adapt the example to match the actual API rather than retrying. # AGO-CLIP and miRNA Target Identification **"Identify direct miRNA-target interactions experimentally"** -> Use Argonaute (AGO1-4) CLIP-seq variants to map miRNA-binding sites on mRNAs, then resolve which miRNA pairs with each site. Three approaches: (a) standard AGO-CLIP recovers AGO-bound sites but cannot say which miRNA; (b) chimeric methods (CLEAR-CLIP, chimeric eCLIP / miR-eCLIP) ligate the miRNA to its target during library prep, producing miRNA-mRNA chimeric reads that unambiguously assign miRNA-target pairs; (c) HEAP uses HaloTag-Ago2 for in vivo profiling. The chi

What's inside
Steps it walks through
  1. Version Compatibility
  2. Methods Taxonomy
  3. Critical Choice: Chimeric vs Computational miRNA-Target Pairing
  4. miRNA-Target Pairing Rules
  5. Chimeric eCLIP / miR-eCLIP Workflow
  6. CLEAR-CLIP (Moore 2015) Analysis
  7. miR-eCLIP Probe Enrichment (Manakov 2022)
  8. Per-Method Failure Modes
  9. Standard AGO-CLIP -- Cannot assign miRNA
  10. Chimeric methods -- Low chimera rate
  11. Hyb -- BLAST sensitivity vs miRNA length
  12. Computational seed matching -- High false positive
  13. Non-canonical miRNA-target pairing missed
  14. HEAP -- Mouse-only
Ships with 2 files
  • examples/run_chimeric_eclip.sh
  • usage-guide.md
Commands it runs
Step 1: eCLIP-style preprocessing (see clip-seq/clip-preprocessing)
umi_tools extract --bc-pattern=NNNNNNNNNN \
cutadapt -a AGATCGGAAGAGCACACGTCT -A AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT \
R1.umi.fq.gz R2.umi.fq.gz
Step 2: Chimera-specific alignment
Chimeric reads have miRNA sequence (21-23 nt) at 5' followed by target mRNA
Step 2a: Trim 5' for miRNA portion + align miRNA part
Step 2b: Trim 3' for target mRNA portion + align target part
Use custom chimeric-eCLIP pipeline OR Hyb (Travis 2014)
Hyb pipeline approach (CLEAR-CLIP and chimeric methods)
More from awesome-bio-agent-skills
All skills →
bio-toolsBiology research tools reference. Always available inside agent containers.AI & Agentssec-reportSEC (size-exclusion chromatography) analysis with peak detection, oligomer classification, and…Code Review & Qualitybio-methylation-callingExtract methylation calls from Bismark BAM files using bismark_methylation_extractor. Generates…Data & Analyticsbio-small-rna-seq-mirdeep2-analysisDiscover novel miRNAs and quantify known miRNAs using miRDeep2 de novo prediction from small…Data & Analyticsreport-templatePublication-quality PDF report generation using Typst templates. Produces professional scientific…Code Review & Qualitybio-variant-callingCall SNPs and indels from aligned reads using bcftools mpileup and call. Use when detecting…Other
About this skill
What does the bio-clip-seq-ago-clip-mirna-targets skill do?

Identify direct miRNA-target interactions from AGO HITS-CLIP, AGO-CLEAR-CLIP (chimeric reads), HEAP (Halo-Ago2 mouse), chimeric eCLIP / miR-eCLIP (deep miRNA-target profiling), or CLASH using chimeric-read processing pipelines, seed-pairing analysis, and 3' auxiliary pairing rules. Use when distinguishing direct miRNA targets from indirect, integrating CLIP-derived target maps with TargetScan / miRDB / DIANA predictions, applying canonical 7mer-8mer seed matching with 3' UTR context, or recovering miRNA-mRNA chimeras at scale.

How do I install it?

Run `npx skills add BioTender-max/awesome-bio-agent-skills --skill ago-clip-mirna-targets --agent claude-code` — it drops the skill into your project so the agent can pick it up. Swap the --agent value for codex, cursor or copilot if you use one of those.

Where does this skill come from?

From BioTender-max/awesome-bio-agent-skills, a repository with 135 stars. We read it straight from the repository tree rather than a submitted listing, so what you see here is what is actually published.

Is a popular skill a good skill?

Not necessarily. Stars measure attention, not adoption — a repository can trend for a week and be abandoned. That is why we show the weekly change from our own snapshots next to the total, instead of a single flattering number.

Keep going
All skills →
The full catalog, by category and by tool.
Open Source Radar →
The repositories these skills come from, watched daily.
The people behind them →
Makers and builders across the ecosystem.