Agent skill · AI & Agents

bio-motif-search

Find patterns, motifs, and subsequences in biological sequences using Biopython. Use when searching for transcription factor binding sites, regulatory elements, or any sequence pattern. For restriction enzyme analysis, use the restriction-analysis skill.

majiayu000github.com/majiayu000GitHub ↗
claude-codeMIT
Install
npx skills add majiayu000/claude-skill-registry --skill motif-search-gptomics-bioskills-2 --agent claude-code

Same command for any agent — swap --agent for codex, cursor, copilot.

Facts
Files in the skill folder: 2
SKILL.md size: 9 KB
Bundled scripts: none
Path: skills/analysis/motif-search-gptomics-bioskills-2/SKILL.md
Open the folder on GitHub →
Where it comes from
Stars: 534
Language: HTML

Weekly change comes from our own snapshots, not the repository page — it measures attention, not adoption.

From the SKILL.md

# Motif Search Find patterns and motifs in biological sequences using Biopython and regex. ## Required Imports ```python from Bio.Seq import Seq from Bio import motifs import re ``` ## Core Methods ### find() - First Occurrence ```python seq = Seq('ATGCGAATTCGATCGAATTCGATC') pos = seq.find('GAATTC') # Returns 4 (first position) ``` Returns -1 if not found. ### count() - Count Occurrences ```python seq = Seq('ATGCGAATTCGATCGAATTCGATC') n = seq.count('GAATTC') # Returns 2 ``` ### find() with Start Position ```python seq = Seq('ATGCGAATTCGATCGAATTCGATC') first = seq.find('GAATTC') # 4 second = seq.find('GAATTC', 5) # 14 (search from position 5) ``` ## Code Patterns ### Find All Occurrences ```python def find_all(seq, pattern): pattern = str(pattern) seq_str = str(seq) positions = [] pos = seq_str.find(pattern) while pos != -1: positions.append(pos) pos = seq_str.find(pattern, pos + 1) return positions seq = Seq('ATGCGAATTCGATCGAATTCGATC') positions = find_all(seq, 'GAATTC') # [4, 14] ``` ### Search Both Strands ```python def find_both_strands(seq, pattern): results = [] for pos in find_all(seq, pattern): results.append(('+', pos)) rc = seq.reverse_complement() for pos in find_all(rc,

What's inside
Steps it walks through
  1. Required Imports
  2. Core Methods
  3. find() - First Occurrence
  4. count() - Count Occurrences
  5. find() with Start Position
  6. Code Patterns
  7. Find All Occurrences
  8. Search Both Strands
  9. Regex Pattern Search
  10. IUPAC Ambiguity Pattern
  11. Find ORFs (Start to Stop)
  12. Find Repeats
  13. Bio.motifs Module
  14. Create Motif from Instances
Ships with 1 file
  • metadata.json
More from claude-skill-registry
All skills →
About this skill
What does the bio-motif-search skill do?

Find patterns, motifs, and subsequences in biological sequences using Biopython. Use when searching for transcription factor binding sites, regulatory elements, or any sequence pattern. For restriction enzyme analysis, use the restriction-analysis skill.

How do I install it?

Run `npx skills add majiayu000/claude-skill-registry --skill motif-search-gptomics-bioskills-2 --agent claude-code` — it drops the skill into your project so the agent can pick it up. Swap the --agent value for codex, cursor or copilot if you use one of those.

Where does this skill come from?

From majiayu000/claude-skill-registry, a repository with 534 stars. We read it straight from the repository tree rather than a submitted listing, so what you see here is what is actually published.

Is a popular skill a good skill?

Not necessarily. Stars measure attention, not adoption — a repository can trend for a week and be abandoned. That is why we show the weekly change from our own snapshots next to the total, instead of a single flattering number.

Keep going