bio-small-rna-seq-mirdeep2-analysis
Discover novel miRNAs and quantify known miRNAs using miRDeep2 de novo prediction from small RNA-seq data. Use when identifying new miRNAs or performing comprehensive miRNA profiling with discovery.
npx skills add majiayu000/claude-skill-registry --skill mirdeep2-analysis --agent claude-code
Same command for any agent — swap --agent for codex, cursor, copilot.
Weekly change comes from our own snapshots, not the repository page — it measures attention, not adoption.
# miRDeep2 Analysis ## Workflow Overview ``` Collapsed reads (FASTA) | v mapper.pl ---------> Align to genome, create ARF file | v miRDeep2.pl -------> Predict novel miRNAs, quantify known | v quantifier.pl -----> Quantify known miRNAs only (optional) ``` ## Step 1: Prepare Genome Index ```bash # Build bowtie index for miRDeep2 mapper bowtie-build genome.fa genome_index ``` ## Step 2: Map Reads with mapper.pl ```bash # Collapse reads and map to genome mapper.pl reads.fastq \ -e \ -h \ -i \ -j \ -k TGGAATTCTCGGGTGCCAAGG \ -l 18 \ -m \ -p genome_index \ -s reads_collapsed.fa \ -t reads_vs_genome.arf \ -v # Key options: # -e: Input is FASTQ # -h: Parse Illumina headers # -k: Clip 3' adapter # -l 18: Discard reads < 18 nt # -m: Collapse reads # -p: Bowtie index prefix # -s: Output collapsed FASTA # -t: Output ARF alignment file ``` ## Step 3: Run miRDeep2 Prediction ```bash # Predict novel miRNAs miRDeep2.pl \ reads_collapsed.fa \ genome.fa \ reads_vs_genome.arf \ mature_ref.fa \ mature_other.fa \ hairpin_ref.fa \ -t Human \ 2> report.log # Arguments: # 1. Collapsed reads FASTA # 2. Genome FASTA # 3. Alignment ARF file # 4. Known mature miRNAs (same species) # 5. Known mature miRNAs (o
- Workflow Overview
- Step 1: Prepare Genome Index
- Step 2: Map Reads with mapper.pl
- Step 3: Run miRDeep2 Prediction
- Prepare miRBase References
- Step 4: Quantify Known miRNAs Only
- Output Files
- Interpret miRDeep2 Scores
- Parse Results in Python
- Related Skills
Build bowtie index for miRDeep2 mapper bowtie-build genome.fa genome_index Collapse reads and map to genome mapper.pl reads.fastq \ Key options: Predict novel miRNAs miRDeep2.pl \ reads_collapsed.fa \ genome.fa \ reads_vs_genome.arf \
What does the bio-small-rna-seq-mirdeep2-analysis skill do?
Discover novel miRNAs and quantify known miRNAs using miRDeep2 de novo prediction from small RNA-seq data. Use when identifying new miRNAs or performing comprehensive miRNA profiling with discovery.
How do I install it?
Run `npx skills add majiayu000/claude-skill-registry --skill mirdeep2-analysis --agent claude-code` — it drops the skill into your project so the agent can pick it up. Swap the --agent value for codex, cursor or copilot if you use one of those.
Where does this skill come from?
From majiayu000/claude-skill-registry, a repository with 534 stars. We read it straight from the repository tree rather than a submitted listing, so what you see here is what is actually published.
Is a popular skill a good skill?
Not necessarily. Stars measure attention, not adoption — a repository can trend for a week and be abandoned. That is why we show the weekly change from our own snapshots next to the total, instead of a single flattering number.
