bio-read-qc-fastp-workflow
All-in-one read preprocessing with fastp including adapter trimming, quality filtering, deduplication, base correction, and HTML report generation. Use when preprocessing Illumina data and wanting a single fast tool instead of separate Cutadapt, Trimmomatic, and FastQC steps.
npx skills add majiayu000/claude-skill-registry --skill fastp-workflow-gptomics-bioskills --agent claude-code
Same command for any agent — swap --agent for codex, cursor, copilot.
Weekly change comes from our own snapshots, not the repository page — it measures attention, not adoption.
# fastp Workflow All-in-one preprocessing tool that handles adapter trimming, quality filtering, deduplication, and report generation in a single pass. ## Basic Usage ### Single-End ```bash fastp -i input.fastq.gz -o output.fastq.gz ``` ### Paired-End ```bash fastp -i R1.fastq.gz -I R2.fastq.gz -o R1_clean.fastq.gz -O R2_clean.fastq.gz ``` ### With Custom HTML/JSON Reports ```bash fastp -i R1.fq.gz -I R2.fq.gz \ -o R1_clean.fq.gz -O R2_clean.fq.gz \ -h sample_report.html \ -j sample_report.json ``` ## Adapter Trimming fastp auto-detects Illumina adapters by default. ```bash # Auto-detect (default) fastp -i in.fq -o out.fq # Specify adapters manually fastp -i in.fq -o out.fq \ --adapter_sequence AGATCGGAAGAGCACACGTCTGAACTCCAGTCA # Paired-end with manual adapters fastp -i R1.fq -I R2.fq -o R1.out.fq -O R2.out.fq \ --adapter_sequence AGATCGGAAGAGCACACGTCTGAACTCCAGTCA \ --adapter_sequence_r2 AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT # Disable adapter trimming fastp -i in.fq -o out.fq --disable_adapter_trimming # Adapter FASTA file fastp -i in.fq -o out.fq --adapter_fasta adapters.fa ``` ## Quality Filtering ```bash # Per-base quality threshold (default Q15) fastp -i in.fq -o out.fq -q 20 # Mea
- Basic Usage
- Single-End
- Paired-End
- With Custom HTML/JSON Reports
- Adapter Trimming
- Quality Filtering
- Quality Trimming
- Length Filtering
- Poly-X Trimming
- N Base Handling
- Deduplication
- Base Correction (Paired-End Only)
- Paired-End Merge
- UMI Processing
fastp -i input.fastq.gz -o output.fastq.gz fastp -i R1.fastq.gz -I R2.fastq.gz -o R1_clean.fastq.gz -O R2_clean.fastq.gz fastp -i R1.fq.gz -I R2.fq.gz \ Auto-detect (default) fastp -i in.fq -o out.fq Specify adapters manually fastp -i in.fq -o out.fq \ Paired-end with manual adapters fastp -i R1.fq -I R2.fq -o R1.out.fq -O R2.out.fq \ Disable adapter trimming
What does the bio-read-qc-fastp-workflow skill do?
All-in-one read preprocessing with fastp including adapter trimming, quality filtering, deduplication, base correction, and HTML report generation. Use when preprocessing Illumina data and wanting a single fast tool instead of separate Cutadapt, Trimmomatic, and FastQC steps.
How do I install it?
Run `npx skills add majiayu000/claude-skill-registry --skill fastp-workflow-gptomics-bioskills --agent claude-code` — it drops the skill into your project so the agent can pick it up. Swap the --agent value for codex, cursor or copilot if you use one of those.
Where does this skill come from?
From majiayu000/claude-skill-registry, a repository with 534 stars. We read it straight from the repository tree rather than a submitted listing, so what you see here is what is actually published.
Is a popular skill a good skill?
Not necessarily. Stars measure attention, not adoption — a repository can trend for a week and be abandoned. That is why we show the weekly change from our own snapshots next to the total, instead of a single flattering number.