bio-crispr-screens-crispresso-editing
CRISPResso2 for analyzing CRISPR gene editing outcomes. Quantifies indels, HDR efficiency, and generates comprehensive editing reports. Use when analyzing amplicon sequencing data from CRISPR editing experiments to assess editing efficiency.
npx skills add majiayu000/claude-skill-registry --skill crispresso-editing-gptomics-bioskills-2 --agent claude-code
Same command for any agent — swap --agent for codex, cursor, copilot.
Weekly change comes from our own snapshots, not the repository page — it measures attention, not adoption.
# CRISPResso2 Editing Analysis ## Basic Analysis ```bash # Analyze single amplicon CRISPResso \ --fastq_r1 sample_R1.fastq.gz \ --fastq_r2 sample_R2.fastq.gz \ --amplicon_seq AATGTCCCCCAATGGGAAGTTCATCTGGCACTGCCCACAGGTGAGGAGGTCATGATCCCCTTCTGGAGCTCCCAACGGGCCGTGGTCTGGTTCATCATCTGTAAGAATGGCTTCAAGAGGCTCGGCTGTGGTT \ --guide_seq CTGCCCACAGGTGAGGAGGT \ --output_folder crispresso_output \ --name sample1 # Output includes: # - Editing efficiency statistics # - Indel distribution # - Allele frequency plots ``` ## With HDR Template ```bash # Analyze HDR editing CRISPResso \ --fastq_r1 hdr_sample_R1.fastq.gz \ --fastq_r2 hdr_sample_R2.fastq.gz \ --amplicon_seq AATGTCCCCCAATGGGAAGTTCATCTGGCACTGCCCACAGGTGAGGAGGTCATGATCCCCTTCTGGAGCTCCCAACGGGCCGTGGTCTGGTTCATCATCTGTAAGAATGGCTTCAAGAGGCTCGGCTGTGGTT \ --guide_seq CTGCCCACAGGTGAGGAGGT \ --expected_hdr_amplicon_seq AATGTCCCCCAATGGGAAGTTCATCTGGCACTGCCCACAGGTGAGGAGGTCATGATCCCCTTCTGGAGCTCCCAACGGGCCGTGGTCTGGTTCATCATCTGTAAGAATGGCTTCAAGATGCTCGGCTGTGGTT \ --output_folder hdr_output \ --name hdr_sample ``` ## Batch Analysis ```bash # Create batch file (tab-separated) # batch.txt: # name fastq_r1 fastq_r2 amplicon_seq guide_seq # sample1 s1_R1.fq.gz s1_R2.fq.gz AM
- Basic Analysis
- With HDR Template
- Batch Analysis
- Pool Analysis (Multiple Guides)
- WGS Analysis
- Parse Results in Python
- Key Output Files
- Quantify Specific Outcomes
- Base Editing Analysis
- Prime Editing Analysis
- Compare Samples
- Related Skills
Analyze single amplicon CRISPResso \ Output includes: Analyze HDR editing Create batch file (tab-separated) name fastq_r1 fastq_r2 amplicon_seq guide_seq sample1 s1_R1.fq.gz s1_R2.fq.gz AMPLICON1 GUIDE1 sample2 s2_R1.fq.gz s2_R2.fq.gz AMPLICON2 GUIDE2 CRISPRessoBatch \ Analyze pooled amplicons
What does the bio-crispr-screens-crispresso-editing skill do?
CRISPResso2 for analyzing CRISPR gene editing outcomes. Quantifies indels, HDR efficiency, and generates comprehensive editing reports. Use when analyzing amplicon sequencing data from CRISPR editing experiments to assess editing efficiency.
How do I install it?
Run `npx skills add majiayu000/claude-skill-registry --skill crispresso-editing-gptomics-bioskills-2 --agent claude-code` — it drops the skill into your project so the agent can pick it up. Swap the --agent value for codex, cursor or copilot if you use one of those.
Where does this skill come from?
From majiayu000/claude-skill-registry, a repository with 534 stars. We read it straight from the repository tree rather than a submitted listing, so what you see here is what is actually published.
Is a popular skill a good skill?
Not necessarily. Stars measure attention, not adoption — a repository can trend for a week and be abandoned. That is why we show the weekly change from our own snapshots next to the total, instead of a single flattering number.