bio-read-qc-adapter-trimming
Remove sequencing adapters from FASTQ files using Cutadapt and Trimmomatic. Supports single-end and paired-end reads, Illumina TruSeq, Nextera, and custom adapter sequences. Use when FastQC shows adapter contamination or before alignment of short reads.
npx skills add FreedomIntelligence/OpenClaw-Medical-Skills --skill bio-read-qc-adapter-trimming --agent claude-code
Same command for any agent — swap --agent for codex, cursor, copilot.
Weekly change comes from our own snapshots, not the repository page — it measures attention, not adoption.
## Version Compatibility Reference examples tested with: FastQC 0.12+, Trimmomatic 0.39+, cutadapt 4.4+, fastp 0.23+ Before using code patterns, verify installed versions match. If versions differ: - CLI: `<tool> --version` then `<tool> --help` to confirm flags If code throws ImportError, AttributeError, or TypeError, introspect the installed package and adapt the example to match the actual API rather than retrying. # Adapter Trimming Remove sequencing adapters from reads using Cutadapt (precise, flexible) or Trimmomatic (paired-end optimized). **"Trim adapters from reads"** → Remove sequencing adapter sequences from FASTQ reads to prevent adapter contamination in downstream alignment. - CLI: `cutadapt -a ADAPTER -o out.fq in.fq` or `trimmomatic PE` with ILLUMINACLIP - CLI: `fastp -i in.fq -o out.fq` (auto-detects adapters) ## Common Adapter Sequences | Platform/Kit | Adapter | Sequence | |--------------|---------|----------| | Illumina TruSeq | Read 1 3' | AGATCGGAAGAGCACACGTCTGAACTCCAGTCA | | Illumina TruSeq | Read 2 3' | AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT | | Nextera | Transposase | CTGTCTCTTATACACATCT | | Small RNA | 3' adapter | TGGAATTCTCGGGTGCCAAGG | | Poly-A | Poly-A tail |
- Version Compatibility
- Common Adapter Sequences
- Cutadapt
- Single-End Reads
- Paired-End Reads
- Adapter Options
- Linked Adapters
- Filtering After Trimming
- Paired-End Filtering
- Action Options
- Trimmomatic
- Single-End Mode
- Paired-End Mode
- ILLUMINACLIP Parameters
cutadapt -a AGATCGGAAGAGC -o trimmed.fastq.gz sample.fastq.gz cutadapt -g ACGTACGT -o trimmed.fastq.gz sample.fastq.gz Both ends cutadapt -a ADAPTER1 -g ADAPTER2 -o trimmed.fastq.gz sample.fastq.gz Multiple adapters (tries each) cutadapt -a ADAPTER1 -a ADAPTER2 -a ADAPTER3 -o trimmed.fastq.gz sample.fastq.gz Basic paired-end cutadapt -a AGATCGGAAGAGCACACGTCTGAACTCCAGTCA \ sample_R1.fastq.gz sample_R2.fastq.gz Short form for Illumina TruSeq (auto-detect)
What does the bio-read-qc-adapter-trimming skill do?
Remove sequencing adapters from FASTQ files using Cutadapt and Trimmomatic. Supports single-end and paired-end reads, Illumina TruSeq, Nextera, and custom adapter sequences. Use when FastQC shows adapter contamination or before alignment of short reads.
How do I install it?
Run `npx skills add FreedomIntelligence/OpenClaw-Medical-Skills --skill bio-read-qc-adapter-trimming --agent claude-code` — it drops the skill into your project so the agent can pick it up. Swap the --agent value for codex, cursor or copilot if you use one of those.
Where does this skill come from?
From FreedomIntelligence/OpenClaw-Medical-Skills, a repository with 2,909 stars. We read it straight from the repository tree rather than a submitted listing, so what you see here is what is actually published.
Is a popular skill a good skill?
Not necessarily. Stars measure attention, not adoption — a repository can trend for a week and be abandoned. That is why we show the weekly change from our own snapshots next to the total, instead of a single flattering number.