bio-genome-engineering-off-target-prediction
Predict CRISPR off-target sites using Cas-OFFinder and CFD scoring algorithms. Identify potential unintended cleavage sites genome-wide and assess guide specificity. Use when evaluating guide RNA specificity or selecting guides with minimal off-target risk.
npx skills add FreedomIntelligence/OpenClaw-Medical-Skills --skill bio-genome-engineering-off-target-prediction --agent claude-code
Same command for any agent — swap --agent for codex, cursor, copilot.
Weekly change comes from our own snapshots, not the repository page — it measures attention, not adoption.
## Version Compatibility Reference examples tested with: pandas 2.2+ Before using code patterns, verify installed versions match. If versions differ: - Python: `pip show <package>` then `help(module.function)` to check signatures - CLI: `<tool> --version` then `<tool> --help` to confirm flags If code throws ImportError, AttributeError, or TypeError, introspect the installed package and adapt the example to match the actual API rather than retrying. # Off-Target Prediction **"Check my guide RNA for off-target sites"** → Search the genome for potential unintended cleavage sites allowing mismatches, then score each off-target by cutting frequency determination (CFD) to assess guide specificity. - CLI: `cas-offinder` for genome-wide off-target search - Python: CFD scoring with mismatch penalty matrices ## Cas-OFFinder (CLI) Cas-OFFinder searches genomes for potential off-target sites allowing mismatches. ```bash # Input file format (input.txt): # Line 1: Path to genome directory (2bit or fasta index) # Line 2: PAM pattern (N = any, R = A/G, Y = C/T) # Line 3+: Guide sequences with mismatch tolerance # Example input.txt: # /path/to/genome # NNNNNNNNNNNNNNNNNNNNNGG # ATCGATCGATCGATCGATCG
- Version Compatibility
- Cas-OFFinder (CLI)
- Cas-OFFinder Input Preparation
- Parse Cas-OFFinder Output
- CFD Score Calculation
- Aggregate Off-Target Score
- CRISPOR-style Analysis
- Related Skills
Input file format (input.txt): Line 1: Path to genome directory (2bit or fasta index) Line 2: PAM pattern (N = any, R = A/G, Y = C/T) Line 3+: Guide sequences with mismatch tolerance Example input.txt: NNNNNNNNNNNNNNNNNNNNNGG ATCGATCGATCGATCGATCGNNN 4 Run Cas-OFFinder cas-offinder input.txt C output.txt # C = use CPU cas-offinder input.txt G output.txt # G = use GPU (faster)
What does the bio-genome-engineering-off-target-prediction skill do?
Predict CRISPR off-target sites using Cas-OFFinder and CFD scoring algorithms. Identify potential unintended cleavage sites genome-wide and assess guide specificity. Use when evaluating guide RNA specificity or selecting guides with minimal off-target risk.
How do I install it?
Run `npx skills add FreedomIntelligence/OpenClaw-Medical-Skills --skill bio-genome-engineering-off-target-prediction --agent claude-code` — it drops the skill into your project so the agent can pick it up. Swap the --agent value for codex, cursor or copilot if you use one of those.
Where does this skill come from?
From FreedomIntelligence/OpenClaw-Medical-Skills, a repository with 2,909 stars. We read it straight from the repository tree rather than a submitted listing, so what you see here is what is actually published.
Is a popular skill a good skill?
Not necessarily. Stars measure attention, not adoption — a repository can trend for a week and be abandoned. That is why we show the weekly change from our own snapshots next to the total, instead of a single flattering number.