bio-crispr-screens-crispresso-editing
CRISPResso2 for analyzing CRISPR gene editing outcomes. Quantifies indels, HDR efficiency, and generates comprehensive editing reports. Use when analyzing amplicon sequencing data from CRISPR editing experiments to assess editing efficiency.
npx skills add FreedomIntelligence/OpenClaw-Medical-Skills --skill bio-crispr-screens-crispresso-editing --agent claude-code
Same command for any agent — swap --agent for codex, cursor, copilot.
Weekly change comes from our own snapshots, not the repository page — it measures attention, not adoption.
## Version Compatibility Reference examples tested with: CRISPResso2 2.2+, pandas 2.2+ Before using code patterns, verify installed versions match. If versions differ: - Python: `pip show <package>` then `help(module.function)` to check signatures - CLI: `<tool> --version` then `<tool> --help` to confirm flags If code throws ImportError, AttributeError, or TypeError, introspect the installed package and adapt the example to match the actual API rather than retrying. # CRISPResso2 Editing Analysis **"Quantify CRISPR editing from my amplicon data"** → Analyze amplicon sequencing to measure indel frequencies, HDR efficiency, and frameshift rates from CRISPR gene editing experiments. - CLI: `CRISPResso --fastq_r1 reads.fq --amplicon_seq ATGC --guide_seq GUIDE` ## Basic Analysis **Goal:** Quantify CRISPR editing outcomes from amplicon sequencing of a single target site. **Approach:** Align amplicon reads against the reference and guide sequences with CRISPResso, which reports indel frequencies, allele tables, and editing efficiency plots. ```bash # Analyze single amplicon CRISPResso \ --fastq_r1 sample_R1.fastq.gz \ --fastq_r2 sample_R2.fastq.gz \ --amplicon_seq AATGTCCCCCAATGGGAAGTTCAT
- Version Compatibility
- Basic Analysis
- With HDR Template
- Batch Analysis
- Pool Analysis (Multiple Guides)
- WGS Analysis
- Parse Results in Python
- Key Output Files
- Quantify Specific Outcomes
- Base Editing Analysis
- Prime Editing Analysis
- Compare Samples
- Related Skills
Analyze single amplicon CRISPResso \ Output includes: Analyze HDR editing Create batch file (tab-separated) name fastq_r1 fastq_r2 amplicon_seq guide_seq sample1 s1_R1.fq.gz s1_R2.fq.gz AMPLICON1 GUIDE1 sample2 s2_R1.fq.gz s2_R2.fq.gz AMPLICON2 GUIDE2 CRISPRessoBatch \ Analyze pooled amplicons
What does the bio-crispr-screens-crispresso-editing skill do?
CRISPResso2 for analyzing CRISPR gene editing outcomes. Quantifies indels, HDR efficiency, and generates comprehensive editing reports. Use when analyzing amplicon sequencing data from CRISPR editing experiments to assess editing efficiency.
How do I install it?
Run `npx skills add FreedomIntelligence/OpenClaw-Medical-Skills --skill bio-crispr-screens-crispresso-editing --agent claude-code` — it drops the skill into your project so the agent can pick it up. Swap the --agent value for codex, cursor or copilot if you use one of those.
Where does this skill come from?
From FreedomIntelligence/OpenClaw-Medical-Skills, a repository with 2,909 stars. We read it straight from the repository tree rather than a submitted listing, so what you see here is what is actually published.
Is a popular skill a good skill?
Not necessarily. Stars measure attention, not adoption — a repository can trend for a week and be abandoned. That is why we show the weekly change from our own snapshots next to the total, instead of a single flattering number.