bio-crispr-screens-base-editing-analysis
Analyzes base editing and prime editing outcomes including editing efficiency, bystander edits, and indel frequencies. Use when quantifying CRISPR base editor results, comparing ABE vs CBE efficiency, or assessing prime editing fidelity.
npx skills add FreedomIntelligence/OpenClaw-Medical-Skills --skill bio-crispr-screens-base-editing-analysis --agent claude-code
Same command for any agent — swap --agent for codex, cursor, copilot.
Weekly change comes from our own snapshots, not the repository page — it measures attention, not adoption.
## Version Compatibility Reference examples tested with: CRISPResso2 2.2+, pandas 2.2+ Before using code patterns, verify installed versions match. If versions differ: - Python: `pip show <package>` then `help(module.function)` to check signatures - CLI: `<tool> --version` then `<tool> --help` to confirm flags If code throws ImportError, AttributeError, or TypeError, introspect the installed package and adapt the example to match the actual API rather than retrying. # Base Editing Analysis **"Analyze my base editing outcomes"** → Quantify base editing efficiency, bystander edits, and indel frequencies from amplicon sequencing data for CBE, ABE, and prime editing experiments. - CLI: `CRISPResso --fastq_r1 reads.fq --amplicon_seq ATGC --base_editor_output` ## CRISPResso2 for Base Editing **Goal:** Quantify base editing efficiency and bystander edits from amplicon sequencing. **Approach:** Run CRISPResso with --base_editor_output and the expected edited amplicon sequence to measure target base conversion, bystander edits, and indel frequencies. ```bash # Analyze base editing with expected outcome CRISPResso --fastq_r1 reads.fq.gz \ --amplicon_seq ATGCGATCGATCGATCGATCGATCG \ --guide_se
- Version Compatibility
- CRISPResso2 for Base Editing
- Key Metrics
- Base Editor Types
- Cytosine Base Editors (CBE)
- Adenine Base Editors (ABE)
- Prime Editing Analysis
- Editing Window Analysis
- Quality Thresholds
- Related Skills
Analyze base editing with expected outcome CRISPResso --fastq_r1 reads.fq.gz \ Prime editing with pegRNA
What does the bio-crispr-screens-base-editing-analysis skill do?
Analyzes base editing and prime editing outcomes including editing efficiency, bystander edits, and indel frequencies. Use when quantifying CRISPR base editor results, comparing ABE vs CBE efficiency, or assessing prime editing fidelity.
How do I install it?
Run `npx skills add FreedomIntelligence/OpenClaw-Medical-Skills --skill bio-crispr-screens-base-editing-analysis --agent claude-code` — it drops the skill into your project so the agent can pick it up. Swap the --agent value for codex, cursor or copilot if you use one of those.
Where does this skill come from?
From FreedomIntelligence/OpenClaw-Medical-Skills, a repository with 2,909 stars. We read it straight from the repository tree rather than a submitted listing, so what you see here is what is actually published.
Is a popular skill a good skill?
Not necessarily. Stars measure attention, not adoption — a repository can trend for a week and be abandoned. That is why we show the weekly change from our own snapshots next to the total, instead of a single flattering number.