bio-crispr-screens-base-editing-analysis
Analyzes base editing and prime editing outcomes including editing efficiency, bystander edits, and indel frequencies. Use when quantifying CRISPR base editor results, comparing ABE vs CBE efficiency, or assessing prime editing fidelity.
npx skills add majiayu000/claude-skill-registry --skill base-editing-analysis --agent claude-code
Same command for any agent — swap --agent for codex, cursor, copilot.
Weekly change comes from our own snapshots, not the repository page — it measures attention, not adoption.
# Base Editing Analysis ## CRISPResso2 for Base Editing ```bash # Analyze base editing with expected outcome CRISPResso --fastq_r1 reads.fq.gz \ --amplicon_seq ATGCGATCGATCGATCGATCGATCG \ --guide_seq TCGATCGATCGATCGAT \ --expected_hdr_amplicon_seq ATGCGATCGATCGTTCGATCGATCG \ --base_editor_output \ -o results/ ``` ## Key Metrics | Metric | Description | |--------|-------------| | Editing efficiency | % reads with target base change | | Bystander edits | Unintended edits in editing window | | Indel frequency | Insertions/deletions (should be low) | | Purity | Target edit without bystanders | ## Base Editor Types ### Cytosine Base Editors (CBE) ```bash # C->T conversion (or G->A on opposite strand) CRISPResso --fastq_r1 reads.fq.gz \ --amplicon_seq $AMPLICON \ --guide_seq $GUIDE \ --base_editor_output \ --conversion_nuc_from C \ --conversion_nuc_to T ``` ### Adenine Base Editors (ABE) ```bash # A->G conversion (or T->C on opposite strand) CRISPResso --fastq_r1 reads.fq.gz \ --amplicon_seq $AMPLICON \ --guide_seq $GUIDE \ --base_editor_output \ --conversion_nuc_from A \ --conversion_nuc_to G ``` ## Prime Editing Analysis ```bash # Prime editing with pegRNA CRISPResso --fastq_r1 reads.f
- CRISPResso2 for Base Editing
- Key Metrics
- Base Editor Types
- Cytosine Base Editors (CBE)
- Adenine Base Editors (ABE)
- Prime Editing Analysis
- Editing Window Analysis
- Quality Thresholds
- Related Skills
Analyze base editing with expected outcome CRISPResso --fastq_r1 reads.fq.gz \ Prime editing with pegRNA
What does the bio-crispr-screens-base-editing-analysis skill do?
Analyzes base editing and prime editing outcomes including editing efficiency, bystander edits, and indel frequencies. Use when quantifying CRISPR base editor results, comparing ABE vs CBE efficiency, or assessing prime editing fidelity.
How do I install it?
Run `npx skills add majiayu000/claude-skill-registry --skill base-editing-analysis --agent claude-code` — it drops the skill into your project so the agent can pick it up. Swap the --agent value for codex, cursor or copilot if you use one of those.
Where does this skill come from?
From majiayu000/claude-skill-registry, a repository with 534 stars. We read it straight from the repository tree rather than a submitted listing, so what you see here is what is actually published.
Is a popular skill a good skill?
Not necessarily. Stars measure attention, not adoption — a repository can trend for a week and be abandoned. That is why we show the weekly change from our own snapshots next to the total, instead of a single flattering number.